Creation: Facts that Support the Biblical Account II
A Sunday guest post by my brilliant husband, Gregg.
Every Sunday, my clever husband offers me a “day of rest” by taking over the homemaker duties here. His primary topic, the Biblical Truth of Creation vs. Darwinism, is a subject that has broad reaching scientific, social, and metaphysical implications and is gaining more and more attention in our modern culture. For believers and non-believers alike, the primary purpose is to present scientific, historical, logical, and/or sociological data in an empirical and defensible fashion, as much as possible written in layman’s terms, and in a format suitable for supplementing any homeschool curriculum whether you choose to believe the Biblical account — or secular guesses — about the origins of human life on earth.
Facts that Support the Biblical Account of Creation
The following are observed facts about nature and the universe that support the Biblical account of Creation. Note that these facts are held up by operational and empirical science.
Complicated Interrelated Functions of Independent Systems—All of the various structures and organs in every living thing are marvelously interrelated. In order to maintain its existence, each part depends on many others. In a wider sense, symbiotic relationships exist when two or more separate and distinct yet interdependent life forms’ very survival depends upon their interrelated functions. For example, plants respire carbon dioxide and expel oxygen as waste while humans expel carbon dioxide as waste and require oxygen to respire.
Extremely Complex and Specific Production Sequence—The plan for every biological structure exists in the life form’s DNA and the code is mysteriously understood by all biological systems. The plan for all biological systems also exists in the same library. Yet the biological systems already exist in every living thing and those systems produce still more complexity at the cellular level each and every second. In fact, the various processes by which things are made in living organisms are complicated in the extreme. Very lengthy and highly specific production sequences are generally required with microscopically precise tolerances at every step of the way. Each step in the procedure must follow still other correctly taken extremely complicated and highly specific steps.
Coded Instructions Which are Referenced and Obeyed—Not only are highly specific and incredibly complex coded instructions provided for everything done in the cell, but proteins and enzymes automatically read and rigorously obey these instructions as though they had the mind, will, and intelligence to do this. There is no explanation for why they do since they, by every fair measure, have no “natural” tendency to do so.
Excessive Information Content and Capacity in Life Forms— Such a capacity, far beyond the bare minimum needed for survival, is repeatedly observed in living things. The brain power of mankind is remarkable. Non-human forms of life also show an abundance of capacity well beyond the amount needed for mere survival such as the number of chromosomes in a simple fern.
The Truth
What is Darwinism, really? At its root, it is a truth claim about human origins. But what is that truth claim after some scrutiny? What is it really? It is a collection of unsubstantiated guesses about unobserved events in the past. What does that have to do with biology, really? Biology is the study of life in the present, is it not? It would seem logical, then, that historians and philosophers should be having this argument over origins instead of people who make their living studying life in the present.
That Biologists continue to argue this point demonstrates even further that this is a philosophical argument, not a scientific argument. This is a debate between two religious groups.
The greatest logical fact in existence that dispels the myth of Darwinism is the complete inability of Darwinists to provide even one solid scientific evidence in support of the entire silly notion. This is a very revealing fact. A “scientific theory” is not scientific at all when it lacks the underlying scientific evidence proving it worthwhile.
Darwinism includes countless unfounded and unscientific pronouncements framed as truth claims, hypotheses, guesses, and theories — all of it built on even more guesses and theories. None of this can dispel the fact that the basic notion upon which they are all piled on top of is totally and utterly lacking in empirical and operational scientific evidence.
Even discounting the thousands of outright frauds perpetrated in the name of Darwin in the last 150 years or so, the truth is that no evidence that is ever presented as “proof” of Darwinism ever stands up to simple logic, is almost never observed or observable, and never enters into the arena of empirical and operational science. Think about that for a moment.
While believers in the Biblical account of Creation are able to almost endlessly present a multitude of scientific evidences that support our divine origin, Darwinists can only respond with ridicule.
That ridicule takes many forms. Ridicule of the believer stating the facts (Ad hominem), ridicule of very minor points never offered as evidence (Straw Man), ridicule of only very minor points offered as evidence while monolithic major points are totally ignored (elephant in the room), equivocation, mockery, intimidation, or other efforts to stifle any discussion.
Darwinists cannot stand an open debate of the scientific merit of their arguments, nor can they ever seem to present valid, sound, cogent scientific data shown to be true by empirical and operational science that tends to support their notions, because they have none.
They have none because — there is none.
The vociferous and fanatical ridicule (that borders on senseless religious fanaticism) and the lack of supporting scientific evidence are abundantly seen in the so-called scientific articles written exclusively in an attempt to refute the Biblical account of Creation. There are entire web communities dedicated to the ridicule of believers that simultaneously do not presenting any actual scientific facts supporting the Darwinist claims.
I commit to you that I will publish every single comment that meets this blog’s commenting criteria. You may want to review that criteria before adding your opinion here.
God Bless you and yours.
Gregg
Resources:
Additional Posts dealing with Creation and Darwinism
Pin It
What I’ve always found difficult is the inability of others to believe in Creationism. For me, it’s much easier to accept and faithfully believe God created this world than it is to not believe it. You don’t have to be able to wrap your head around the ‘how’ is it possible. You just have to have the faith that it is possible. Besides…I really don’t want to think I evolved from a speck that grew legs and crawled out of the ocean. That’s just too bizarre! LOL
Great post! Happy Friday! :)
In his own book Darwin admitted that there were key points in his theories that were unexplained or missing and before his death most of them were proven wrong by his peers. You don’t have to use so many big words to convince us because Darwin did it himself.
“…..as though they had the mind, will, and intelligence to do this. There is no explanation for why they do since they, by every fair measure, have no “natural” tendency to do so.”
.
What are you talking about here. What’s wrong with chemistry as an explanation for the proteins and enzyme activity? Really, this does sound ridiculous to me, but maybe you can clarify.
.
.
My son was just using this topic for a speech at his school. I’m going to show him this, he’ll love it.
…”Complicated Interrelated Functions of Independent Systems—All of the various structures and organs in every living thing are marvelously interrelated.”
.
This fits just fine with evolutionary theory.
Right. Well, why would it be? If they were not complex and interrelated, it also wouldn’t present a problem. Anything seen through the lense of a philosophical bias rarely presents an insurmountable problem. It is only when you drop the bias and look at it using no bias and pure logic that it actually presents a monolithic problem for the theory.
So then when you make statements that support biblical creation are you meaning simply that they are consistent with biblical theory? Or that they support biblical creation better than evolutionary biology? Or that they support biblical creation but are in contradiction with evolution?
So what is the monolithic problem that you see for evolution from complex interrelated systems, because I see none. At every new development, every genetic change, the organism inheriting that change must be able to survive and pass the genetic change on to descendants. This means the change must by definition be compatible with all the current processes in that lifeform or it could not be passed on.
There’s a health book you might have seen in bookstores called IIRC “The pH Miracle” by Robert Young. Aside from his ideas about pH in the body, he also mentions in his book a very strange idea he has about blood cells. He and some others have the idea that blood cells can change into bacteria and fungi in the body. This idea comes from someone at the time of Pasteur; I think his name was Bechamp. He looked in the microscope back then and thought he could see cells morphing into other lifeforms. There was also someone named Enderlein who picked up the idea later. People like Young think that Pasteur was wrong. The strange thing is that they reject 150 years of microbiology, of genetics, of electron microscopy, and choose to stick with this very crude observation made with primitive equipment back when Pasteur did his experiments. Those ideas have been rejected, discredited, left behind years ago. Probably most people in medical research have never heard of them and if they did they would think they were ridiculous. There is no way to take them seriously since there is no evidence for them and there is a mountain of evidence against them. Is it bias for medical researchers to ignore their claims?
It really depends. The fact of high complexity and interdependency contradicts evolutionary biology because randomness never generates order. Randomness only ever generates randomness. Chaos never generates complexity. It only ever generates chaos. You must look at these facts objectively and logically without the Darwinian philosophical bias before it stands in stark contradiction to the theory.
See previous comment. Complex information (so-called level six information or apobetic information) cannot be generated by means of random, undirected processes.
You could be talking about several levels here. For the simplest levels, (e.g. the orgin of living cells) it isn’t pure chaos and ransomness because you have chemical properties. But I was thinking this point was not about the origin of life because you mentioned organs and symbiosis.
When you talk about structures and organs, I assume you’re talking at the level of single cells or multicellular organisms. Once you have a single-celled organism with some genetic structure and the ability to make proteins, acquire energy and reproduce, you already have complexity and order in the cell as a basis for developing multicellular structures.
For the intracellular structure of mitochondria the current idea (which has good support) is that the mitochondria were once bacteria (archaea) living inside other bacteria which together became the eukaryotic cell. This is also thought to be the origin of chloroplasts in plant cells.
You toss out “chemical properties” as if chemicals naturally form highly complex information systems. They don’t.
I get that this is an allegory but I’m not sure if you are comparing Darwinism or a belief in the Biblical account of creation to the magical blood to bug book. Regardless, the allegory itself is not evidence, but merely an allegory. If the magical blood to bug book is your metaphor for believers in the Biblical account of creation, then your allegory amounts to pure ridicule and, while artful, remains absent evidence to support Darwinism.
.
What I was hoping for was evidence that supports Darwinism instead of simple ridicule.
I should add, chemical properties are not the only non-random thing in an early earth. there would also be periodic natural phenomena like days and nights, tides, seasons. And there would be spatial gradients.
.
You said:
…”The fact of high complexity and interdependency contradicts evolutionary biology because randomness never generates order.”
But evolutionary biology starts at the point where there are functioning cells with a genetic code, able to produce proteins and other biochemicals, and able to reproduce.
(and I maybe I should add (although I must have said this before) that biological evolution is not random. It involves random (or mostly random) mutations and other factors which maybe could be considered random – some environmental events, population drift. But you have the nonrandom effect of selection on the individuals in the population – which ones survive, which ones have better reproductive success etc.)
You put biblical creation up against evolution here. I think what you’re saying could be interpreted this way – that you don’t think natural processes can explain complex lifeforms, therefore the cause has to be supernatural. In that way, your argument is consistent with biblical creation but does not specifically support biblical creation over any other supernatural explanation that could be made.
Origin of life is definitely an unexplained series of events. To me, unexplained and unlikely is not the equivalent of unexplainable and impossible. But even if the origin of life was a supernatural event, it does not follow IMO that the origin of every type of organims was therefore a supernatural event. Once there is some kind of reproducing single-celled organism with some kind of geenetic code, you have the raw material for biological evolution, for which there is consistent evidence.
hd: “…evolutionary biology starts at the point where there are functioning cells with a genetic code, able to produce proteins and other biochemicals, and able to reproduce.”
.
So evolutionary biology utterly ignores the fact that getting to that point requires design? That’s a bit like cherry picking, isn’t it?
And again, selection is a reductive process that never ADDS any information to the genetic code. You must already have ACATAGACATAGACATAGAAACCC in order to eliminate AAACCC. This does not infuse new information into genomes. Also, “selection” is a misnomer since nature has no will, no mind, no plan. It CANNOT select. Therefore, the interbreeding of like species is effectively random since there is no guarantee that the most fit male will breed with the most fit female even if one can span the almost complete subjectivity of which is the most “fit” in a population.
What is the incontrovertible consistent evidence that is supported by 1) observable, operational, empirical science and 2) logic?
….”And again, selection is a reductive process that never ADDS any information to the genetic code. You must already have ACATAGACATAGACATAGAAACCC in order to eliminate AAACCC. This does not infuse new information into genomes. Also, “selection” is a misnomer since nature has no will, no mind, no plan. It CANNOT select. Therefore, the interbreeding of like species is effectively random since there is no guarantee that the most fit male will breed with the most fit female even if one can span the almost complete subjectivity of which is the most “fit” in a population.”
.
Selection doesn’t add information to the genetic code – it is mutation that adds information – by a combination of types of mutation including single nucleotide changes, inserts or deletions and inversions, gene or genome duplication, effects of retrovirsuses moving sections of DNA into new places.
.
You may not think ‘selection’ is the best word choice but it is the word which is used.
For example, think of a population of deer or antelopes. There are a variety of environmental features that limit the number of animals in that population. Predators will try to take their offspring or attact the adults. Variations in weather will affect their survival – colder winters, drier summers, different food choices. Disease. If there are too many animals they must compete for limited food. All these factors are acting on the population in any particular location. As long as there is genetic variation in the population which causes phenotypic differences that these forces can act on, there will be a difference in reproductive success for the animals whose phenotype improves their ability to survive and reproduce in that particular environment. Selection doesn’t mean some overall plan. It refers to all the challenges that a population of organisms encounters in its environment which affect the reproductive success of any individual.
Another form of selection in animals relates to mate choice. For instance the genes of one animal will have a better chance of being passed on if that animal’s mate is healthy. Things like more colorful feathers in birds can be a sign of health, and a instinct to choose a more colorful mate (which is coded in the DNA) increases the chance for a bird to choose a healthy mate.
…”So evolutionary biology utterly ignores the fact that getting to that point requires design? That’s a bit like cherry picking, isn’t it?”
.
First, getting to that point does not ‘require’ design.
Second, although investigating the origin of life, as well as the earliest lifeforms, is definitely a field of study, it is not necessary to have that information to study evolution once the first single-celled organisms were in existence on earth.
Okay — so in a population of deer, let’s say we have some really “fit” deer and in their genome exists the following dominants by group: AAACCC, AAAGGG, AAATTT, CCCTTT (These are notional). So, environmental factors wipe out all of the AAACCC. Disease wipes out all the AAAGGG. Predators eat all the AAATTT. In the entire deer population, you are left with CCCTTT and there is no way to add back AAACCC, AAAGGG, AAATTT into the gene pool via “selection” which is, as I said, a reductive action.
.
Your argument is that mutation will add AAACCC, AAAGGG, AAATTT back in, but the truth is that more than 90% of mutations are benign and recessive and nearly all of the mutations that are not benign are harmful or fatal.
.
The fact is that mutation cannot account for the existing information infused in living things, nor can “selection” and nor can the two in tandem. The truth is there is no satisfactory explanation that relies entirely upon a materialistic philosphical bias.
Your first statement is an opinion based on no evidence and not supported by logic. Your second statement is confirmation of the cherry picking involved in the argument.
.
If you allow someone one arbitrary assumption, they could “prove” anything. If you allow me only one arbitrary assumption, I could prove that pigs can fly.
…:Your argument is that mutation will add AAACCC, AAAGGG, AAATTT back in…”
.
No, that is not my argument at all. If all the deer in that population carrying those alleles died, then those alleles might never occur again in that population, especially if several mutational steps had happened to produce them.
If those alleles still occurred in deer in other populations, they could be brought back to that population by migration.
.
(Your example assumed that all those alleles were gone, and in specific circumstances that could happen. But I’ll mention that since each deer can have two alleles, chances are that some of the deer are heterozygotes with different alleles and you wouldn’t lose all those alleles at the same time. I’m also assuming in your example that you are talking about four alleles for the same gene, not alleles for different genes. )
“… but the truth is that more than 90% of mutations are benign and recessive and nearly all of the mutations that are not benign are harmful or fatal.”
.
The idea that almost all mutations are neutral and some are harmful does not lead to the conclusion that none are beneficial. If there are many animals in a species and you talk about many years, even with estimating a small percent of a low mutation rate, there is room for beneficial mutations.
(There was a recent paper that looked at two humans separated by 13 generations. They counted mutations between them in one section of the genome and used that value to estimate an average mutation rate. IIRC it was 7 mutations per individual in the whole genome.)
You said:
….”Your first statement is an opinion based on no evidence and not supported by logic. Your second statement is confirmation of the cherry picking involved in the argument.
.
If you allow someone one arbitrary assumption, they could “prove” anything. If you allow me only one arbitrary assumption, I could prove that pigs can fly.”
.
.
Well, no surprise, I don’t agree with you. I’m not interested in arguing the first point at this moment.
But as for the second point, it seems to me that it depends on the question that is being asked. I think you want each question to be reduced to Genesis vs. the big bang. But I don’t agree that that is necessary. It’s possible to ask the question of whether from pre-existing single-celled organims we can trace the evolution of other species. This isn’t a question out of nowhere – there is fossil evidence of arcahea long before there were more advanced organisms. (I imagine you reject this evidence.) It is possible to ask whether there is an evolutionary basis for thinking that fish were the ancestors of mammals. Ecah question can be considered separately. You want things to default to Genesis, but maybe there was a supernatural creator who created the Archaea and let things develop from there. Or maybe there was a creator who made fish and let things develop from there. You don’t have to start with the big bang, or a universe with no supernatural actions in order to consider these questions.
I’m not sure what cherry picking implies – it sounds like you’re using it as a dismissive term. And because I think the questions are separate legitimate questions, I don’t think it applies. But also it seems to me that it is not necessarily a negative approach to a problem. If you’e confronted with something that is largely unknown you have to start with what is accessible to your research and move in from the outside. As you clarify one area it allows you to investigate related areas.
So what I get is that you are conceding that so-called “Natural Selection” is a reductive process and that once certain genetic traits become lost from a species they are likely lost forever. What I am getting is that you also concede that mutation is not a viable engine to replace those lost traits.
.
What I neglected to mention are the foundational arguments against so-called “macro-evolution” which are specifically these: 1) that even though a deer loses traits through reductive processes such as natural selection, it remains a DEER as does its progeny and 2) that neither natural selection nor mutation can account for infusing the vast amounts of information found in the genome.
Before I researched as deeply and thoroughly as I did, I was under the misconception that Darwinism and an understanding of the Biblical account of creation could agree and go hand in hand. My thought was that perhaps God created a single celled organism and then every body type and species and living thing came from that “seed” via macro-evolution. Knowing what I know now — that macro-evolution never occurs and cannot occur — I realize that the Biblical account of creation is probably more likely. Specifically, that God created EVERY body type (e.g.: Cambrian explosion) and that all species evolved down from those original body types via what Darwists call “micro-evolution” and normal people call parents having children.
.
What I mean by cherry picking is in a basket of 5 issues (an apple, an orange, a grape, a pear, and a cherry) you only want to talk about the cherry. To have a complete debate, you have to discuss the entire bowl of fruit. The cherry by itself proves almost nothing. To ignore the entire bowl of fruit except for the cherry is cherry picking. It isn’t dismissive, it is describing an incomplete debate.
.
I have no problem with discussing unknowns. My issue is with discussing unknowns as if they were facts and truths when they are, in reality, based on assumptions.
….”So what I get is that you are conceding that so-called “Natural Selection” is a reductive process and that once certain genetic traits become lost from a species they are likely lost forever. What I am getting is that you also concede that mutation is not a viable engine to replace those lost traits.”
.
.
Yes, that’s what I was saying. It would depend on the exact genetic trait lost on how likely it would be that that mutation or mutations could happen again, but I think odds are that they wouldn’t, especially if it were a set of several mutations in order. This is different from saying that that set of mutations could not have happened originally, and it is different from thinking that other mutations would not occur in the future. (I hope what I just said is correct as far as probability goes.)
….”Specifically, that God created EVERY body type (e.g.: Cambrian explosion) and that all species evolved down from those original body types via what Darwists call “micro-evolution” and normal people call parents having children.”
.
.
The fossils of the Cambrian explosion did not contain all the body types which would be considered Biblical ‘kinds’, in case that isn’t clear. You would still need what you have called macroevolution to get from the Cambrian fossils to the creatures alive today.