Creation: Facts that Support the Biblical Account I
You are currently browsing comments. If you would like to return to the full story, you can read the full entry here: “Creation: Facts that Support the Biblical Account I”.
Hallee the Homemaker
Loving a Life of Biblical Womanhood
I disagree with everything in this post.
Your list of ‘observed facts’ are not observed facts.
Biology is not only the study of life in the present but life in general.
I appreciate your comment and your sentiment even though you do not list any scientific evidence or facts that contradict my points. Only ridicule.
Where’s the ridicule? You did not document your facts.
I think the post speaks for itself. If you cannot see that I DID, in fact, present facts — you see no facts at all — then further debate will likely be fruitless.
.
Ignoring my points and pretending I presented nothing tangible is a bit “ridiculous,” which is just another form of ridicule.
“Mathematically impossible—Mathematicians have repeatedly estimated that the likelihood of DNA, enzymes, amino acids, and proteins being randomly assembled by the chance methods offered by Darwinian guesses is impossible by many orders of magnitude”
.
It is easy to take a sequence and calculate the huge odds against it having been assembled in one step from a random list of nucleotides or amino acids. That is a straw man. That is not the way evolution is thought to have happened.
Where are the mathematical arguments showing that it is mathematically possible?
I don’t know – I’d have to look to see if there are any. But I don’t think mathematical arguments are necessarily useful in this case. You’d have to define the conditions mathematically in order to make a model, and I don’t think there’s enough information to give probabilities for origin of life conditions.
Let me see if I understand what you are saying. First you say I didn’t present any facts. Then you say that the fact I presented about the mathematical impossibility of Darwinist models is a straw man. Then, that fact isn’t relevant. So — in other words, a lot of subtle ridiucule. But you have yet to present any scientific/mathematical evidence or facts that contradict what I said. This is my understanding so far.
.
David Berlinksi PhD (neither a Christian nor a creationist, if it matters) has taken the ACTUAL models proposed by Darwinists and shown them to be mathematicaly unsound and in large part mathematically impossible. Therefore, I beg to differ with your view that this is a straw man argument since he is pretty specific.
.
Additionally, he is fairly observant. For instance, he observes that if it takes 50,000 morphological changes to go from fish to mammal, all in order, and someone presents a salamander as a transitional form — you are still missing 49,999 transitional forms between fish to mammal. But that is kind of a side issue.
.
If you have any facts or scientific/mathematical evidence that support your counterpoint, I would sincerely be interested in exploring them.
“Irreducible complexity—The various components of every living creature in the world are so complicated and interrelated, that it could not function without every last one of them in place. There is simply no way that some of the parts could have been “evolved” at need and added later. Biochemists and microbiologists know this and have no sound, valid, cogent explanation for it that leaves out living things having been created”
.
I’m not sure I understand what you mean when you say ‘every living creature’.
Is this all separate lifeforms and not just the earliest hypothetical lifeform or the common ancestor?
Let’s go back to the fish. Could a particular fish survive if one of its compnents were taken away? Probably not, depending on what you mean by components. Could a tetrapod survive without its components? Probably not. But that is different from the idea that a fish or fish population could have variations which do not interfere with survival. And later populations of fish could have other variations not interfering with survival. And after many generations, the accumulations of variations could in fact mean that the fish has morphed into a tetrapod.
.
.
“There is simply no way that some of the parts could have been “evolved” at need and added later. Biochemists and microbiologists know this…”
.
What are you saying they know ? Evolutionary biology does not say that functions evolve “at need’, so definitely biochemists and microbiologists would know that ; to imply that things are thought to evolve “at need” is a misrepresentation of biology. On the other hand, if you mean that biochemists and microbiologists “know” that parts could not have EVOLVED (without the “at need” part) then this is false. You are possibly implying that biochemists are lying and concealing information that they ‘know” – if so, that is worse than ridicule. Are you implying that biochemists and microbiologists reject evolution? That is false.
.
“Biochemists and microbiologists …have no sound, valid, cogent explanation for it that leaves out living things having been created”
.
Obviously biochemists and microbiologists and molecular biologists and evolutionary biologists think they do have valid sound cogent explanations – it is you who reject them
(I need to back off from this for now or I will get nothing else done all day.)
Often you post things about scientists (you use the word ‘Darwinists’, but I don’t see how that doesn’t include the vast majority of scientists) that I think are ridiculing and insulting. Mostly I try to ignore those remarks and try to focus on the details that you post.
Sometimes I think you post things which are to me ridiculous, but mostly I try to give you the benefit of the doubt, assuming that you have more understanding about the topic than you have put into your post and that you are just simplifying or being sarcastic. And sometimes from your reponses that turns out to be true. But if you interpret what I posted here as ridicule, rather than being a straightforward reaction, then it’s useless to avoid ridicule, and from now on maybe I will state upfront when I see something that strikes me as ridiculous. I don’t think I’m good at that kind of argument, and it doesn’t seem to me to be very useful, but maybe I’ll try it.
….”Additionally, he is fairly observant. For instance, he observes that if it takes 50,000 morphological changes to go from fish to mammal, all in order, and someone presents a salamander as a transitional form — you are still missing 49,999 transitional forms between fish to mammal. But that is kind of a side issue.”
.
From what I can tell, he made that comment not about fish to mammals but about the transition from a certain extinct land animal living a semi-aquatic life to a whale (which makes it even better for your argument, of course, if it happens to be valid). However his number of 50,000 was, he said, a back-of-the-envelope calculation. He listed maybe ten or so general changes. How he got up to 50,000, I wouldn’t know, I don’t see any sources that might contain more specific detail – maybe you know of one. What is his basis for that 50,000 or is he just making up numbers? What is this observation that he makes that results in that number? Without some basis, why should I respect that number?
.
He says something about how he sees the value of the Ambulocetus fossil for evolution (if I’m remembering the name right). This was a first, a rare find IIRC. The existence of fossils, in particular their existence in places where they can be found intact by paleontologists, is a rare thing. So they find this one rare fossil and Berlinskie thinks we should be able to find 49,999 others? When finding one was a rare event? That makes no sense to me and seems to ignore the realities of paleontology. And he was talking about aquatic animals and ocean animals – again it’s luck if those animals were fossillized in a place where they could be found.
.
Let’s say there are a great number of morphological changes which would happen between the semi-aquatic mammal and the whale. How many of those changes would actually result in differences in bone? Differences that could be seen in fossils? He mentioned the changes in skin, in the eye covering, changes in the lactation methods for feeding the babies. Why would those changes be expected to show up in fossils?
How many changes in bone would be distinct between one species and another?
He mentioned the breathing apparatus – I think there IS a series of whale skulls showing the migration of the blowhole in different fossil species.
.
(I’d be better off taking your site off my blog reader list. I think I have a google compulsion :-(
At least I made Hallee’s rootbeer BBQ beef for dinner last night, so there’s some benefit. And I’ve read a lot of new things.)
We would miss you terribly. :-(
You say, “Often you post things about scientists (you use the word ‘Darwinists’, but I don’t see how that doesn’t include the vast majority of scientists) that I think are ridiculing and insulting.”
.
There are a possibility of 3 logical fallacies in that sentence.
.
First is equivocation, where you accuse me of equivocating Darwinists with scientists. In reality, I am always very careful to make a distinction between the two since Darwinism is a religious/philosophical belief structure and being a scientist is a choice of vocation. The allegory would be that I were equivocating Scientologists with “the majority” of hotel maids or landscapers, for example. This does not follow.
.
Since your argument relies upon equivocation that is not actually present, this amounts to a straw man fallacy. This doesn’t follow.
.
Lastly, you state that the “majority of scientists” are Darwinists in your opinion. This could be the fallacy of a bandwagon appeal or Argumentum Ad Populum. It could also be the no true Scottsman argument. As in, “Scottsman eat porridge,” but my father-in-law is Scottish and doesn’t eat porridge and the reply is, “Well no TRUE Scottsman doesn’t eat porridge.” So, any scientist who isn’t also philosophically a Darwinist, in your book, isn’t a TRUE scientist. This also doesn’t follow.
.
You said, “I don’t think I’m good at that kind of argument, and it doesn’t seem to me to be very useful, but maybe I’ll try it.”
.
Certainly your choice but a more effective means of argumentation might be to simply present actual FACTS or evidence that is supported by empirical/operational science that supports your argument in the first place instead of ridiculing my words and attacking my character.
As I said, this is kind of a side-issue that I would like to explore in more detail later, but the skull series you refer to — if it is the one I am familiar with — makes no allowance for scale. It is the same old worn out homology argument that is utterly arbitrary where a bat wing and a whale fin are supposed to be homologous even though a whale fin is thousands of times greater in size. The skulls in that series vary vastly in scale within the series but are always depicted as small to large as if there is a logical progression. Very deceptive IMHO.
hd: I’m not sure I understand what you mean when you say ‘every living creature’.
Is this all separate lifeforms and not just the earliest hypothetical lifeform or the common ancestor?
.
Me: All living things. For example, I could not live very long without the multiple processes involved in blood clotting. My fitness cost would be greatly reduced without the mylin sheathing surrounding my spinal cord. I could not live very long without the blood cell factories in the marrow of my bones. Etc., etc. ad nearly infinitum. All of these highly complex interdependent processes exist in me all at once. How do I “evolve” the ability for my blood to clot? If that was not already present in my distant ancestors along with all of the other interdependant processes at the outset, they would have all bled to death if not doing every day chores then certainly in child birth.
.
At the microscopic level, if all of the micro-machines that are responsible for that organism’s survival were not present at the outset — such as a flagellum or cilia just for example — it would have had a hard time getting to the food.
.
I’m not really talking about incidental variations like hair and eye color. I am talking about all of the vastly complex interdependent components that are required for survival. They would have had to be present ALL AT ONCE, would they not?
.
hd:…to imply that things are thought to evolve “at need” is a misrepresentation of biology.
.
Me: No it isn’t. This is the basis of punctuated equilibrium theory. The theory goes that life forms remain in an unchanging “stasis” for long ages then suddenly “evolve” millions of mutations all at once. This astoundingly ridiculous concept — that millions of beneficial mutations occur once every 50,000 years or so to two creatures, a male and female, who are apparently living near enough to each other—thus producing a new species pair — is outlined in “Return of the Hopeful Monsters,” in Natural History, June-July, 1977, Gould and Eldredge. This was first suggested in 1972 in “Punctuated Equilibria: An Alternative to Phyletic Gradualism,” 1972, ibid.
.
In short, I don’t think I am misrepresenting anything, only representing what Darwinists purport as truth claims.
I think you are wrong. First, there is no “at need” in Gould’s and Eldredge’s theory. Second, your description of what you think punctuated equilibrium says seems to me like a complete misunderstanding of the idea of punctuated equilibrium. You site two articles. I don’t think they say anything about punctuated equilibrium that matches what you said in your comment. If you think, as you said, that they outline an idea of punctuated equilibrium that fits with your description above, you could supply some quotes from those articles that match what your comment says. Gould is, I think, very wordy, and I have trouble following him. But I think your view above about the millions of beneficial mutations and the male and female pair are totally off the wall as a picture of Gould’s ideas.
(should have been “cite”, not “site” above)
Myelin is not an example of irreproducible complexity as an argument against evolution. Nerve cells do not have to be myelinated in order to function; not all your neurons are myelinated. Having myelin is necessary for humans now, but that doesn’t mean it was necessary for a pre-fish ancestor to the vertebrates. Some primitive chordates (IIRC) don’t have any myelinated axons, for instance the lamprey. Some invertebrates have particular types of myelin (not the same as vertebrates have) while others do not.
hd — myelin sheathing is a great example. It is required for human beings and most mammals. Assuming the molecules to man model of Darwinian evolution is valid, how could myelin sheathing “evolve” if it didn’t already exist? Would it “evolve” because it was needed? Does that sound a little too designed?
.
And while I really admire the ridicule of all of MY evidence, you do realize that you have yet to put forth any evidence of your own that actually supports the theory and is backed by observable operational science, do you not?
…”Assuming the molecules to man model of Darwinian evolution is valid, how could myelin sheathing “evolve” if it didn’t already exist? Would it “evolve” because it was needed?”
.
I don’t know how myelin sheathing evolved (note – *I* don’t know – other people might have ideas. You could to read up on it to find out). But It doesn’t seem like a problem. Myelin sheathing is made by glial cells that wrap around the axons. Glial cells are already present in juxtaposition to axons. A mutation that caused a type of glial cells to wrap more tightly and for longer might have been the initial cause. If it improved conduction then those animals might survive better by responding faster to danger. It did not happen because it was needed; it happened randomly and became a part of the population because it improved the survival of those animals compared to the ones which didn’t have the mutation. The raw material – glial cells in this case – was already present. Other steps would have happened before the system we have now in mammals was in place but none of them would have been designed. (I imagine you’ll be able to ridicule this answer.)
(You might ask yourself: if a designer was involved why there is one system in vertebrates and three other somewhat different systems in different invertebrates. If a common designer designed them all, and that apparently designer liked reusing plans, why were the plans not re-used in this case?)
.
As far as my answers go, I do better with small questions. Trying to frame larger ones gives me mental gridlock. Maybe you’ll never get a wider answer from me. If not, then that’s the way it goes. Maybe some other commenter will do better. (I started reading about the limb homology question BTW.)
(I’m almost incapable of writing or saying “irreducible” complexity. I type the wrong thing almost every time.)
Is it ridicule to say that something is incorrect?
hd: “I don’t know how myelin sheathing evolved (note – *I* don’t know – other people might have ideas. You could to read up on it to find out). But It doesn’t seem like a problem. ”
.
It never “seems” like a problem until the details are presented and analyzed. Then there is always an assumption, an unfounded and mathematically impossible assertion that forms a majority of the premise, or a logically unsound contradiction that must be accepted “for now” until a better explanation is found.
.
The truth is there is no scientific evidence that supports the notion that this could occur. If a living thing doesn’t need myelin, then why would it “evolve” something it doesn’t need? Is there some plan in place that it somehow realizes that future generations would need it to improve their fitness cost? Isn’t natural selection a reductive action where un-needed traits are discarded?
I have another piece of evidence for your list: Darwinism can’t explain feelings. That is one of the main reasons why I now think that Darwinism doesn’t make sense.
To think of it another way, you could build a robot that would react like a human if it was ‘hurt’. What you can’t do is build a robot that feels pain. You can make it look as though it is feeling pain, but that is a different thing. Effectively, Darwinism says that we are all robots, so why are we capable of feeling pain, and what does it mean when we do?
….”If a living thing doesn’t need myelin, then why would it “evolve” something it doesn’t need? Is there some plan in place that it somehow realizes that future generations would need it to improve their fitness cost?”
.
Does an animal population without myelin need myelin? No – it is surviving in its habitat without it. But if some animals have myelin on some neurons that are involved in recognizing or escaping from danger, and because of a faster conduction speed in the axon those animals can escape from predators better, then those animals would have a higher survival rate in the population. Also maybe having myelin lets organisms get larger- larger animals might survive better with faster conduction in some longer axons and myelin is one way to have that happen. The animals wouldn’t NEED to be larger; again it would be chance mutations. (There might be earlier benefits to the axons from the nearby glial cells even before the insulation effect happens – I’m not in the mood to do a search right now though. I’m giving ideas to think about, not polished arguments.) Oh yeah, I think that aside from increasing conduction velocity, myelin decreases the enrgy needed to transmit the action potential.
.
And again, mutations don’t happen because of need! They happen by chance.
Obviously you know that some mutations result in changes that those individual organisms DON’T need: they are harmful, and that organism doesn’t survive or doesn’t reproduce as well. or its off spring are less successful than those without the mutation, etc. Some mutations are changes the organism doesn’t need because they make essentially no difference to the organism; they are neutral.
Some mutations make little difference one way or another and the organism doesn’t need them, but maybe in a different environment the change will turn out to be helpful. Or maybe in the current environment it will turn out to be useful. The mutation didn’t happen because it was needed. It was just as random as the negative or neutral ones.
(I’t may be that during some kinds of stress in some type of organism the mutation rate increases = I think I read something like this but forgot. If that’s true, you could say it was a response to need. But the mutation itself is random,)
.
….”Isn’t natural selection a reductive action where un-needed traits are discarded?”
.
Natural selection is much broader and less specific than that. But it seems like you’re thinking of a situation where myelin is developed when there is no benefit for it. As I said above, it is likely that there is benefit from it.
But if myelin were developed and it was not harmful but also not beneficial, it would probably stay in the population until it was disabled by further mutation. Unneeded traits that are not harmful to the animal can be discarded when mutations that disable those traits turn out not to be harmful to the organism, so that the organism lacking in that genetic mechanism stays in the population and pass the disabled gene sequence or whatever on. I’m thinking of the disabled enzyme for making vitamin C in primates and guinea pigs. In some animals the inability to make vitamin C would cause the animal to be less able to survive, so the gene would maintain its functional sequence in the population. Those animals without it would be less successful in surviving to reproduce or in reproducing and raising their offspring in the whatever range of environmental conditions the population experiences.
.
(I’ve spent too much time typing this – need to stop. I hope there aren’t too many typos or errors.)
Me: Assumptive words have been emphasized by me…
.
hd: …But **IF** some animals have myelin on some neurons …Also **MAYBE** having myelin lets …larger animals **MIGHT** survive better …(There **MIGHT** be earlier benefits
.
Me: This is all assumption. Assumption is not evidence. Assumption is not backed by empirical, operational, observable science. Assumption is essentially, “Let’s suppose that perhaps possibly maybe because these assumptions more closely fit my philosophical bias.”
.
hd: Obviously you know that **SOME** mutations result in changes that those individual organisms DON’T need: they are harmful, and that organism doesn’t survive or doesn’t reproduce as well.
.
Me: My understanding is that more than 98% of mutations are either neutral (no net change in the organism) or harmful to lethal.
.
hd: …**MAYBE** in a different environment the change will turn out to be helpful. Or **MAYBE** in the current environment it will turn out to be useful.
.
Me: Assumption.
.
As I said above, it is **LIKELY** that there is benefit from it. But if myelin were developed [my note: Do you mean developed randomly through chaotic and undirected processes?] and it was not harmful but also not beneficial [in other words, neutral], it would **PROBABLY** stay in the population until it was disabled by further mutation. Unneeded traits that are not harmful to the animal can be discarded when mutations that disable those traits turn out not to be harmful to the organism, so that the organism lacking in that genetic mechanism stays in the population and pass the disabled gene sequence or whatever on.
.
Me: This is a huge assumption that begs the question.
.
hd: I’m thinking of the disabled enzyme for making vitamin C in primates and guinea pigs. In some animals the inability to make vitamin C would cause the animal to be less able to survive, so the gene would maintain its functional sequence in the population. Those animals without it would be less successful in surviving to reproduce or in reproducing and raising their offspring in the whatever range of environmental conditions the population experiences.
.
My take: The Vitamin C vector is DESIGNED and exists in the genome as a set of highly specific instructions that certain environmental vectors will trigger, just as additional sunlight triggers additional melanin in my skin cells. This did not come about as a result of random, undirected processes. This was engineered so that living things could respond to a wide range of environmental stresses and still survive.
.
Thanks for your comment.
.
God Bless,
Gregg
…”My take: The Vitamin C vector is DESIGNED and exists in the genome as a set of highly specific instructions that certain environmental vectors will trigger, just as additional sunlight triggers additional melanin in my skin ”
.
That’s not just an assumption but it is an unreasonable assumption. It’s not possible that it could be true because the accumulated mutations in the enzyme make it impossible that it could function no matter what triggers occurred. (and what circumstances could you imagine for triggers anyway – humans have lived in environments all over the globe and have died of scurvy when there was not enough vitamin C in their diets.) The simple conclusion is that humans inherited the multiply-mutated enzyme from their non-human primate ancestors.
I admit it is an assumption which I placed in the comment in direct juxtaposition to your goo-to-you-by-way-of-the-zoo assumption.
.
You have presented no evidence that my assumption is unreasonoble, you have only ridiculed my assumption as unreasonable. Since I readily confess a design assumption, the thing we must investigate is whether or not my assumption is more strongly supported by evidence and therefore worthy of your ridicule.
.
“The evolutionary claim that pseudogenes and their respective variations are shared between primates in a nested hierarchy, and can only be explained through common evolutionary descent, is found wanting. Evidence for pseudogene function continues to accumulate, and is much more significant than the actual number of known functional pseudogenes. In addition, pseudogene-related phenomena show considerable differences between ‘close’ primates, and are neither self-consistent nor in agreement with other phylogenetic interpretations. Furthermore, pseudogene deployment and alteration are governed by strongly non-random events. Unless [Darwinists] can rigorously demonstrate that pseudogene-related phenomena cannot occur independently in different primates, their ‘shared mistakes’ argument should be rejected.” John Woodmorappe, Technical Journal, 14(3):55–71
.
Your assumption is “Molecules–>Monkeys–>Man” which leaves out other living things that have the same genetic predisposition such as Guinea Pigs. Where do they fit into our alleged evolutionary tree since you brought them up? Answer? They don’t. Not at all, nor any of the creatures on their “branch” of the so-called “TREE OF LIFE.” Yet Guinea Pigs are also unable to metabolize ascorbic acid.
.
“When the human and guinea pig sequences (647 nucleotides in total) of the regions of exons 4, 7, 9, 10, and 12 were compared, we found 129 and 96 substitutions in humans and guinea pigs, respectively, when compared with the rat sequences. The same substitutions from rats to both humans and guinea pigs occurred at 47 nucleotide positions among the 129 positions where substitutions occurred in the human sequences.” Inai, Y., Ohta, Y. and Nishikimi, M., The whole structure of the human non-functional L-gulono-γ-lactone oxidase gene—the gene responsible for scurvy—and the evolution of repetitive sequences thereon, J. Nutritional Science and Vitaminology (Tokyo) and ref. 32, p. 316 and 49(5):315–319, 2003.
.
But how can this be? Did we inherit this from the noble Guinea Pigs or did they inherit it from humans? Which is it, mighty Darwin?
.
“Detailed examination of the relevant sequence (47 positions among the 647 nucleotides) reveals no obvious pattern suggestive of a straightforward explanation for this abundance of parallel nucleotide substitutions. The distribution of the 47 positions is: Exon 4 (6 positions), Exon 7 (10), Exon 9 (10), Exon 10 (9) and Exon 12 (12). The positions themselves are spread out subequally across each exon. None of the 47 positions occur more than two in a row, and there are only two sites (four total positions) in which the positions occur two in a row. There are only four indels, none more than 3 nucleotides long, in the five exons of the three collective sequences. None of the 47 positions is associated with an indel. In fact, none of the 47 positions occur within three nucleotides of an indel. All sixteen possible doublets of nucleotides are associated with the 47 positions of parallel mutation, and there is no strongly preferred doublet tending to mutate to any one of the 47 positions. Furthermore, only 3 of the 47 positions are associated with the highly mutable CG doublet. None of the 47 positions are associated with homopolymeric runs (e.g. AAAAAA …). Four same-site stop codons (3 TGA and 1 TAA) have been independently created in the guinea pig and human GULO pseudogenes, if all three overlapping ORFs (open reading frames) are considered. None of these four stop codons could have originated from a CG doublet.” Woodmorappe, J., ibid.
.
Obvious conclusion: Pseudogenes, such as the GULO responsible for the human inability to metabolize our own ascorbic acid, must be recognized as non-canonical genes as well as truly disabled genes. The two categories are not mutually exclusive, and the scientist must accommodate both eventualities.
.
This is actual science — empiracle, observational, operational science — uninfluenced by a philosphical bias that REQUIRES me to conclude that this particular pseudogene function is the result of monkeys to man Darwinism. Actual science has no philosphical bias that causes one to utterly IGNORE the obvious evidence contradicting the Darwinist model “simple” conclusion — a conclusion which the EVIDENCE clearly does not support.
.
My very REASONABLE assumption, then, is that given the now recognized widespread functionality in pseudogenes, the notion of ‘shared mistakes’ is a Darwinist assumption that yields to the Designer inference of ‘shared engineering and/or artistic similarities’—as is recognized by unbiased scientists for all homologies encountered between living organisms.
.
Do you have at your disposal any actual evidence — absent unfounded ridicule — that contradicts the above?
.
Thank you for your comment.
God Bless,
Gregg
Since you have apparently used an Answers in Genesis (Journal of Creation) post as your source, I refer you to a Panda’s thumb post which responds to this question:
http://pandasthumb.org/archives/2004/09/scurvy-guinea-p.html
.
In case you don’t want to read the Panda’s Thumb post, the message is this – The Inai paper didn’t take into consideration the fact that the rat sequence could also have had changes after it diverged from the other lines. For exon 10, for example, if you look at the bases where both human and guinea pig sequences have the same bases different from rat, the same base also occurred in most of the other animal sequences he looked at. In these cases it was not that humans and guinea pigs had identical mutations at a much higher rate than expected, but that guinea pig and humans did not have mutations – it was the line leading to rats which had the mutation.
I hope that makes sense.
.
I add these further results from exon 10 for two more animals (it would be possible for me to copy some other results but maybe this makes the point):
Oryctolagus cuniculus (rabbit)
GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTG
YYYYYYYYYYYAYYYYYYYYGYYYYYYYYGYYYYYYYYYYYYYYYYYGYYYYYYGYGYYY
GTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC
YYGYYYYYYYYYYYYYYGYYYYYYYYYYYTGYYYYGYYYYYYYYYYYCYYYYYYYYYYY
TGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTACAG
YYYYYTYYYYYYYYGYYYYYYYYYYYCYYYYYYYYCYYYYYYYY
Canis lupus familiaris
GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTG
YYYYYYYYYYYYYYYYYYYYGYYYYYAYYGYYAYYYYYYYYYYYYYYYYYYYYYYYGAYY
GTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC
YYGYYYYYYYTYYYTYYGYYYYYCYYYYYYYYYYYCYYGYYYYYYYYCYYYYYYYYYYYY
TGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTACAG
YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYCYYYYYYYY
.
(The Ys stand for bases which are the same as in rat. Really, this is hopeless – I tried using periods and hyphens but they were too short to line up and the Os were too long to line up. There should be the same number of letters in each line, but I don’t know how to make them match up in easily comparable pairs. Also I tried to underline the bases which were the same as those for humans and guinea pigs but this commenting feature doesn’t let me paste in underlined letters. But you can see those in the Panda’s Thumb post.)
(probably no point in adding this note, but to be clearer – in my comment with the sequences, the main sequence in each case (the top lines with the As, Cs, Gs, & Ts) was from the rat. The lines below that are mostly Ys show where there are differences from the rat for each of those two animals. This was meant to be similar to the Panda’s Thumb figure, but I couldn’t figure out how to get the letters on the two lines to match up.)
At the end of the day, it is still an ASSUMPTION of molecules to man. This is not evidence that reasonably supports a “simple” Darwinist conclusion. One must possess the Darwinian philosophical bias to look at this evidence and conclude that some “unknown” evolutionary force explains all of the unanswered questions and thus conclude this is some kind of hard evidence against design and for random chance.
There’s no ‘unknown’ force needed.
You asked this:
…”….”If a living thing doesn’t need myelin, then why would it “evolve” something it doesn’t need? Is there some plan in place that it somehow realizes that future generations would need it to improve their fitness cost?”
.
In the question I was responding to above, you didn’t ask something like, what is the exact sequence of molecular changes in extinct vertebrates that led from unmyelinating glial cells to glial cells that produced myelin? You asked why a living thing that didn’t need myelin would evolve myelin.
.
My answer was not meant to give evidence for the exact evolutionary processes which led to myelin. I don’t know that much about myelin. My answer was addressing your questions about the evolutionary mechanism, which you seemed not to understand. For you to respond to me answer by pointing out words which suggested assumptions was to miss the point.
.
I also think you picked out words that sounded like assumptions without trying to see how they were used in context.
For instance, I said this:
…”Does an animal population without myelin need myelin? No – it is surviving in its habitat without it. But if some animals have myelin on some neurons that are involved in recognizing or escaping from danger, and because of a faster conduction speed in the axon those animals can escape from predators better, then those animals would have a higher survival rate in the population.”
.
and you picked out the word “if” as an assumptive word to highlight. You ignored the actual logical idea that I was expressing.
.
Let’s see if I can say that without using “if”:
In order to survive and reproduce, organisms have to avoid being eaten by predators before they reproduce. The ability of an organism to escape predators is improved by the organism’s quickness at detecting a predator and fleeing. Myelinated neurons have a faster conduction velcity than unmyelinated neurons. A faster conduction velocity means that messages from the receptors that detect predators can more quickly be transmitted to the neurons that send messages to the muscles, and those messages can be more quickly be sent to the muscles. Those organisms with neurons with faster conduction velocity will have a higher probability of escaping predators and as a result they will have a higher probability of reproducing and passing on their DNA. A mutation that improves the conduction velocity will logically be increased in the population.
As I understand it, the idea of irreducible complexity is fairly specific. (of course you could tell me if I’m wrong.) It does not address the whole of evolutionary theory, mutation, natural selection etc. It is used to address the idea of the likelihood that some particular structure could have evolved. Behe liked the example of the bacterial flagellum. The idea says that assuming evolution could happen as it is proposed to work, in this particular specific case, evolutionary theory fails to explain it. For this particular example to work, several parts all have to function, and without all these parts, the thing (whatever thing we are talking about, bacterial flagellum, the eye, or your example of myelination) cannot function. These parts could not have evolved separately because separately they would have had no survival value. So even if you accept the ideas of evolution, evolution could not logically explain this particular example.
To use the specific idea of ‘irreducible complexity’ as an observed fact, as you said in your post, it seems to me that you have to have an example of irreducible complexity. For this reason I don’t think myelin is a useful example. If you say that mutation is too rare and natural selection is useless, you aren’t talking about the argument of irreducible complexity, you’re back to attacking evolution in general. If you say that we don’t know every single step in the pathway, IMO you aren’t talking about irreducible complexity, you’re arguing in general. To say that something supports biblical creation because it is an example of irreducible complexity I think you have to be very specific in showing how that example has a set of features which all would have to have been in place for it to work as it does, and you need a reasonable argument that separately that those features would have had no function.
For myelin, I gave some general reasons why it is not irreducibly complex. Neurons don’t have to be myelinated to function. Glial cells were there before there were myelinating glial cells. Glial cells associate with axons. Glial cells support axons; there is a benefit for their presence without myelination. Myelination has advantages. If you want to argue that myelination is an example of irreducible complexity you have to do what Behe did and address the molecular level. I don’t think you can do that. I don’t know what information we have at this time. I don’t know myself – I’d have to read up on it – and I don’t think you know either. I don’t think you have a basis for saying that myelination is irreducibly complex.
You didn’t respond to this, and I think I left a comment on some other post about punctuated equilibrium that you didn’t respond to..
So I can’t tell if you have changed your understanding about what the ideas about punctuated equilibrium are.
To repeat, I think your view above about the millions of beneficial mutations and the male and female pair are totally off the wall as a picture of Gould’s ideas, and that you don’t actually understand what Gould and Eldredge meant by puntuated equilibrium. I don’t know whether you actually read the sources you mentioned.
You are criical or dismissive or ridiculing of assumptive words like ‘could have’, might, or ‘some’.
.
Just for the record, I have a similar negative reaction to words like ‘always’ and ‘never’, especially without qualifications or details. An example in your post above:
…”The various components of every living creature in the world are so complicated and interrelated, that it could not function without every last one of them in place. There is simply no way. that some of the parts could have been “evolved” at need and added later.
.
(Also for the record, I don't think Behe succeeded in making his case for the bacterial flagellum. I'm not interested in arguing about it though; there is a lot online addressing that point)
YOu conclude: “In order to survive …Myelinated neurons have a faster conduction velcity than unmyelinated neurons. … Those organisms with neurons with faster conduction velocity will have a higher probability of escaping predators …”
.
Okay. So we have a population of organisms who do not have myelin sheathing. Then predation or some other environmental stressing vector is taking place and a fortuitous mutation occurs in certain members of the population such that they now have myelin sheathing. That raises their fitness cost so that they produce progeny and replenish the population.
.
The base assumption is that such a fortuitous mutation can occur in the first place. The metaphor is a football stadium filled with people. A group sets up a .50 caliber machine gun on the 50 yard line and starts hosing down the audience. A male and female in the audience mutate fortuitously into being bullet proof and these two decide they like each other and they mate and make lots of bullet proof progeny who replenish the population of the stadium.
.
That is not a base assumption I am willing to make.
I am pretty sure I responded to it in another post.
Assumptions (do not equal) Evidence.
.
Always and never are sometimes perfectly appropriate. For example, life only ever and always comes from life and never comes from non-living things. In that context, this proves true 100% of the time in 100% of cases in 100% of all possible environments.
That’s definitely possible. I lose track of things.
your comment:
…”The base assumption is that such a fortuitous mutation can occur in the first place. The metaphor is a football stadium filled with people. A group sets up a .50 caliber machine gun on the 50 yard line and starts hosing down the audience. A male and female in the audience mutate fortuitously into being bullet proof and these two decide they like each other and they mate and make lots of bullet proof progeny who replenish the population of the stadium.
.
That is not a base assumption I am willing to make.”
.
Whether the mutation or mutations can take place is another question, but there are two parts to your analogy that I think do not fit the myelin scenario.
First, you have the people mutating into being bullet-proof, which suggests it is a life-or death, all-or-nothing issue. This does not match the evolutionary explanation. The population of organisms without myelin would have survived without it. Lampreys don’t have myelin and they have not been wiped out by predators. Members of the population with myelin would have had an advantage in survival compared to ones without myelin.
The second problem, which really boithers me every time it comes up is the idea that there would have to have been both a male and a female with this mutation and they would have had to have located each other. Sorry, but if you want to talk ridicule, this is ridiculous.
How so? It takes 2 to Tango if I am not mistaken, from Lampreys to Seals to Snails to just about anything with myelin.
…”How so? It takes 2 to Tango if I am not mistaken, from Lampreys to Seals to Snails to just about anything with myelin.”
.
It takes two to reproduce, but those two do not have to have the same mutation in order to reproduce.
The first organism with a mutation would only have it on one chromosome anyway.
.
If the mutation occurred in an embryonic germline stem cell, the initial mutation could be passed on to more than one offspring of the organism in which it occurred. In that case there would be siblings or half siblings with that mutaion in the same location at the same general time. If this happened, then a male and female with the same mutation could easily become a pair. There would not need to be the improbability of the exact same mutation happening twice at the same general time in two different organisms and offsprings of those organisms just happening to find each other.
.
But for most mutations there is no need for the animal to find a mate with the same mutation.
.
The only situation I can think of where a mate with the same mutation might be necessary or at least improve the probability of successful reproduction (I personally don’t know, just speculating) would be for some chromosome duplications or some specific chromosome rearrangements. FWIW there can be chromosome rearrangements which do not prevent successful reproduction with mates not having that rearrangement.
I’m sure I’ve commented on other posts that an organism with a new mutation is able to reproduce with other members in its population which don’t have that mutation.
But if you are unconvinced or think it’s unclear, let me know what the issue is and I’ll try to answer. It’s hard for me to figure out why you think there would be a problem, and that makes it hard for me to address the specific issue you have with it.
All (sexually reproducing) organisms contain their genetic information in paired form. Each offspring inherits half its genetic information from its mother, and half from its father. So there are two genes at a given position (locus, plural loci) coding for a particular characteristic. An organism can be heterozygous at a given locus, meaning it carries different forms (alleles) of this gene. For example, one allele can code for blue eyes, while the other one can code for brown eyes; or one can code for the A blood type and the other for the B type. Sometimes two alleles have a combined effect, while at other times only one allele (called dominant) has any effect on the organism, while the other does not (recessive).
.
In the event that the mutation is such that it requires two alleles, both the male and female parent would have to have the proper mutation for that mutation to carry out to subsequent generations.
.
How is that ridiculous?
We seem to be using different meanings for the word mutation. I think that you are using a more casual definition of the word mutation, meaning the observed effect of a genetic mutation, not the actual mutation itself. I’m talking about mutation as the actual change in the DNA.
So when you say the male and female have to find each other, I thought you meant that a male and female without the same genetic mutation could not reproduce. But now I think you mean that if the genetic mutation is recessive, in order to see the phenotypic effect you need a male and female pair which each have at least one copy of the variant allele. Okay, that makes some kind of sense. But you still don’t need to imagine two separate identical mutations. An organism that is heterozygotic for a variant recessive allele can reproduce with other organisms in its population and the recessive allele will be spread in the population so that there are an increasing number of heterozygotes in the population carrying the variant allele from the initial mutation. When they reproduce, there will be some offspring which have two copies of the recessive allele.
Maybe I will add more to this later.
I’m still not positive that I have understood or addressed your point, so let me know if this clarifies things or not.